%expand% GATCGGAAGAGCGGTTCAGCAGGAATG %set(body,%html-clean({
I knew it was some kind of primer, adapter or barcode - but I wasn't sure which, whether to trim, or if the barcode came before or after.

BLAS*T searches turned up nothing, but Joel answered, within a second, "it's an adapter sequence". He said "I just Googled it".

Reminder to self... Google searching DNA sequences works (NOTE: Bing didn't).
}))
   
Bracing against the wind  
www.documentroot.com  

Wednesday, February 23, 2011

GATCGGAAGAGCGGTTCAGCAGGAATG

I knew it was some kind of primer, adapter or barcode - but I wasn't sure which, whether to trim, or if the barcode came before or after.

BLAS*T searches turned up nothing, but Joel answered, within a second, "it's an adapter sequence". He said "I just Googled it".

Reminder to self... Google searching DNA sequences works (NOTE: Bing didn't).

[View/Post Comments] [Digg] [Del.icio.us] [Stumble]

Home | Email me when this weblog updates: | View Archive

(C) 2002 Erik Aronesty/DocumentRoot.Com. Right to copy, without attribution, is given freely to anyone for any reason.


Listed on BlogShares | Bloghop: the best pretty good | Blogarama | Technorati | Blogwise